ID: 1148446235_1148446245

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1148446235 1148446245
Species Human (GRCh38) Human (GRCh38)
Location 17:47739287-47739309 17:47739331-47739353
Sequence CCAGCCTCTTCCTGTGTCTCCAT ACAGGATGAGCTGGGCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 90, 4: 917} {0: 1, 1: 5, 2: 147, 3: 4352, 4: 28395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!