ID: 1148462717_1148462723

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1148462717 1148462723
Species Human (GRCh38) Human (GRCh38)
Location 17:47847599-47847621 17:47847640-47847662
Sequence CCAGCGCAGGTGCGCCTTCAGGT CTTTCCCGCAGCCCGGGATGTGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 3, 3: 5, 4: 136} {0: 1, 1: 0, 2: 1, 3: 12, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!