ID: 1148479217_1148479232

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1148479217 1148479232
Species Human (GRCh38) Human (GRCh38)
Location 17:47949289-47949311 17:47949339-47949361
Sequence CCTATCAGCCGTGCACTTTATTG ACCCCCAAGGAGGGGACTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!