ID: 1148495629_1148495641

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1148495629 1148495641
Species Human (GRCh38) Human (GRCh38)
Location 17:48051868-48051890 17:48051913-48051935
Sequence CCTACACATGCCAGGGTGTTTAC CTGGAGGCCTGGGGTGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 129} {0: 1, 1: 4, 2: 32, 3: 333, 4: 2186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!