|
Left Crispr |
Right Crispr |
| Crispr ID |
1148501782 |
1148501786 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:48097127-48097149
|
17:48097140-48097162
|
| Sequence |
CCTGTAATTCCAGCTACTTAGGA |
CTACTTAGGAGGCCTGAGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 161, 1: 8858, 2: 122955, 3: 249956, 4: 275165} |
{0: 2, 1: 41, 2: 209, 3: 756, 4: 2128} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|