|
Left Crispr |
Right Crispr |
| Crispr ID |
1148501782 |
1148501788 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:48097127-48097149
|
17:48097159-48097181
|
| Sequence |
CCTGTAATTCCAGCTACTTAGGA |
CAGGAGAATCACTTGAACCGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 161, 1: 8858, 2: 122955, 3: 249956, 4: 275165} |
{0: 475, 1: 57011, 2: 130808, 3: 165988, 4: 198564} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|