|
Left Crispr |
Right Crispr |
| Crispr ID |
1148501784 |
1148501791 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:48097136-48097158
|
17:48097168-48097190
|
| Sequence |
CCAGCTACTTAGGAGGCCTGAGG |
CACTTGAACCGAGGAGGCGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 43, 2: 293, 3: 1100, 4: 4462} |
{0: 24, 1: 7049, 2: 42996, 3: 108232, 4: 151876} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|