ID: 1148534633_1148534639

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1148534633 1148534639
Species Human (GRCh38) Human (GRCh38)
Location 17:48429594-48429616 17:48429619-48429641
Sequence CCTGGCCTTGGCCCATGGGGATC ATGAGCCCCTCGCAGCCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 497} {0: 1, 1: 0, 2: 0, 3: 19, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!