ID: 1148534733_1148534746

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1148534733 1148534746
Species Human (GRCh38) Human (GRCh38)
Location 17:48430005-48430027 17:48430045-48430067
Sequence CCGTGGGAGGCCTGGTGTCCCCT CACTGGAGGGGGCCTGCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 315} {0: 1, 1: 0, 2: 1, 3: 19, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!