ID: 1148535458_1148535474

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1148535458 1148535474
Species Human (GRCh38) Human (GRCh38)
Location 17:48434839-48434861 17:48434892-48434914
Sequence CCCTCCTCCATCTAAATAGTAAT GCAGGGGGATCACTTGAGGCAGG
Strand - +
Off-target summary No data {0: 5, 1: 214, 2: 2209, 3: 12423, 4: 65348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!