ID: 1148556595_1148556606

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1148556595 1148556606
Species Human (GRCh38) Human (GRCh38)
Location 17:48582224-48582246 17:48582261-48582283
Sequence CCTGCGCACCGGCGGCGGCGGCG GCCCAGAGGGGGCGCGGGCGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 20, 3: 150, 4: 661} {0: 1, 1: 0, 2: 2, 3: 42, 4: 531}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!