ID: 1148578320_1148578325

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1148578320 1148578325
Species Human (GRCh38) Human (GRCh38)
Location 17:48726627-48726649 17:48726647-48726669
Sequence CCAGGCCGCTCCTGAGGAACAGT AGTCCAGCAGCCAGTGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104} {0: 1, 1: 1, 2: 1, 3: 34, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!