ID: 1148579512_1148579519

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1148579512 1148579519
Species Human (GRCh38) Human (GRCh38)
Location 17:48734104-48734126 17:48734129-48734151
Sequence CCTGCGGGGCTATAGCTCTCAGC CCGGAGCCTGCGCTTGGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 56} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!