ID: 1148586987_1148586995

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1148586987 1148586995
Species Human (GRCh38) Human (GRCh38)
Location 17:48787983-48788005 17:48788011-48788033
Sequence CCTTGGCTTCCTCAATCCTGTTG CAGAACATGGGGCTGCTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 469} {0: 1, 1: 0, 2: 0, 3: 22, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!