ID: 1148587376_1148587387

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1148587376 1148587387
Species Human (GRCh38) Human (GRCh38)
Location 17:48790669-48790691 17:48790689-48790711
Sequence CCCTCTTCCCACCACACCTACAA CAAGGGCTGGGAATGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 413} {0: 1, 1: 0, 2: 3, 3: 103, 4: 797}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!