ID: 1148616045_1148616057

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1148616045 1148616057
Species Human (GRCh38) Human (GRCh38)
Location 17:48999830-48999852 17:48999878-48999900
Sequence CCCATTGTTACCAGGGGACCATC TGTGAGCTGGGGCTCTTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 87} {0: 1, 1: 0, 2: 0, 3: 25, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!