ID: 1148618252_1148618268

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1148618252 1148618268
Species Human (GRCh38) Human (GRCh38)
Location 17:49015635-49015657 17:49015676-49015698
Sequence CCCCCCATTCTCTGTGCTTCCAC TGGGAGCCACTCAAGGTCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 448} {0: 1, 1: 0, 2: 0, 3: 12, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!