ID: 1148643337_1148643345

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1148643337 1148643345
Species Human (GRCh38) Human (GRCh38)
Location 17:49204538-49204560 17:49204588-49204610
Sequence CCTTCTCTTGAGCAGAGTATATG CAGAATGGTGAGATGGAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 150} {0: 1, 1: 0, 2: 2, 3: 24, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!