ID: 1148646690_1148646698

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1148646690 1148646698
Species Human (GRCh38) Human (GRCh38)
Location 17:49223492-49223514 17:49223534-49223556
Sequence CCCGCGAGGGTGACTTTGGTGAA ATAGACGAGGCTGGGATGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109} {0: 1, 1: 0, 2: 1, 3: 20, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!