ID: 1148656455_1148656464

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1148656455 1148656464
Species Human (GRCh38) Human (GRCh38)
Location 17:49287380-49287402 17:49287424-49287446
Sequence CCTGGGTTCAAGTGATTCTCCTA GATTACAGGTGCCCACCACCAGG
Strand - +
Off-target summary {0: 1184, 1: 39305, 2: 112874, 3: 177587, 4: 236080} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!