ID: 1148656463_1148656473

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1148656463 1148656473
Species Human (GRCh38) Human (GRCh38)
Location 17:49287412-49287434 17:49287458-49287480
Sequence CCTGAGTAGCGGGATTACAGGTG TTGTATTTTTAGTAGAGATGGGG
Strand - +
Off-target summary {0: 15, 1: 188, 2: 870, 3: 8341, 4: 99617} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!