ID: 1148664987_1148664995

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1148664987 1148664995
Species Human (GRCh38) Human (GRCh38)
Location 17:49367792-49367814 17:49367823-49367845
Sequence CCCACCTCCCACCAGCCCTACTT GTAAATAGTAATTAAATGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 568} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!