ID: 1148674710_1148674729

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1148674710 1148674729
Species Human (GRCh38) Human (GRCh38)
Location 17:49438681-49438703 17:49438728-49438750
Sequence CCCGCCCGTGCCTGGCCACAGGC CGGCCCCCAAAGAGCAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 355} {0: 1, 1: 0, 2: 4, 3: 18, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!