ID: 1148678057_1148678066

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1148678057 1148678066
Species Human (GRCh38) Human (GRCh38)
Location 17:49456533-49456555 17:49456579-49456601
Sequence CCCCCTCCACTCTGGTCACGCTG TGCTTCTCAGCTATTACCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 226} {0: 1, 1: 0, 2: 0, 3: 20, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!