ID: 1148678137_1148678150

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1148678137 1148678150
Species Human (GRCh38) Human (GRCh38)
Location 17:49456969-49456991 17:49457015-49457037
Sequence CCTCCACCCTGTAAGCATGTAAG CTCTTCTCTGGGGTGTGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 111} {0: 1, 1: 0, 2: 1, 3: 20, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!