ID: 1148685155_1148685168

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1148685155 1148685168
Species Human (GRCh38) Human (GRCh38)
Location 17:49496735-49496757 17:49496786-49496808
Sequence CCTGGCTCTCGGTGCAAGCCGCT ACGCCTCGGATTCTGTAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 172} {0: 1, 1: 0, 2: 0, 3: 1, 4: 9}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!