ID: 1148685354_1148685362

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1148685354 1148685362
Species Human (GRCh38) Human (GRCh38)
Location 17:49497577-49497599 17:49497604-49497626
Sequence CCGCCTCCGCCTCGGCGCGCGGC CGGTCTGGGATGGCTGTGCGCGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 3, 3: 43, 4: 368} {0: 1, 1: 0, 2: 2, 3: 8, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!