ID: 1148686769_1148686772

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1148686769 1148686772
Species Human (GRCh38) Human (GRCh38)
Location 17:49505461-49505483 17:49505502-49505524
Sequence CCTTCTCCTTATTCTGGAGTGCA ACATGAGTGAAGAATGAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 184} {0: 1, 1: 0, 2: 2, 3: 21, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!