|
Left Crispr |
Right Crispr |
| Crispr ID |
1148715363 |
1148715371 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:49711865-49711887
|
17:49711899-49711921
|
| Sequence |
CCGGGCACGGTGGCTCACGCCTA |
CTTTGGAAGGCCAAGGTGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 768, 1: 15146, 2: 72131, 3: 127206, 4: 156024} |
{0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|