ID: 1148722279_1148722298

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1148722279 1148722298
Species Human (GRCh38) Human (GRCh38)
Location 17:49763005-49763027 17:49763052-49763074
Sequence CCCTCACCCCACTGCCACGTTGG CTTGGTGGGTAGAGGGGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 180} {0: 1, 1: 0, 2: 4, 3: 78, 4: 809}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!