ID: 1148736807_1148736818

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1148736807 1148736818
Species Human (GRCh38) Human (GRCh38)
Location 17:49869630-49869652 17:49869650-49869672
Sequence CCCCCACCCCCGGGCCCAGGACT ACTTCTGGTGCTGCAGATCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 84, 4: 952} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!