ID: 1148767205_1148767211

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1148767205 1148767211
Species Human (GRCh38) Human (GRCh38)
Location 17:50046351-50046373 17:50046377-50046399
Sequence CCAACCCTATCCCAGGGTCTTTG AATTGCCAGCTCCAGCTTCTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!