ID: 1148775998_1148776013

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1148775998 1148776013
Species Human (GRCh38) Human (GRCh38)
Location 17:50096026-50096048 17:50096074-50096096
Sequence CCCCTGGGCAGAGGGTGAGATTA CTCTTTCAGAAGATGCCATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 201} {0: 1, 1: 0, 2: 0, 3: 23, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!