ID: 1148783466_1148783467

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1148783466 1148783467
Species Human (GRCh38) Human (GRCh38)
Location 17:50134195-50134217 17:50134220-50134242
Sequence CCAATTTGGGGTTAAAGTGGGGA CAGAGTCGATTTCACTTAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 85} {0: 1, 1: 0, 2: 2, 3: 5, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!