ID: 1148783915_1148783924

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1148783915 1148783924
Species Human (GRCh38) Human (GRCh38)
Location 17:50135945-50135967 17:50135969-50135991
Sequence CCGCCCAGCCCCCAGCCACGTAC TCTGCTGGTAGTCCTTGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 511} {0: 1, 1: 0, 2: 3, 3: 11, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!