ID: 1148785407_1148785412

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1148785407 1148785412
Species Human (GRCh38) Human (GRCh38)
Location 17:50143835-50143857 17:50143872-50143894
Sequence CCCACAACTGAAGAAGGGATATA CTTTGCCAAGTCTACTAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 67, 4: 787} {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!