ID: 1148791858_1148791866

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1148791858 1148791866
Species Human (GRCh38) Human (GRCh38)
Location 17:50177786-50177808 17:50177838-50177860
Sequence CCATAACCAAACGGGTTCTTTGA TATTTCTTTCTTTCTCCTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 15, 3: 248, 4: 2052}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!