ID: 1148795475_1148795480

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1148795475 1148795480
Species Human (GRCh38) Human (GRCh38)
Location 17:50194791-50194813 17:50194810-50194832
Sequence CCAGCAGGGCCAGGGGGTCCTTG CTTGAACACCAACAGGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 48, 4: 408} {0: 1, 1: 0, 2: 0, 3: 10, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!