ID: 1148824563_1148824575

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1148824563 1148824575
Species Human (GRCh38) Human (GRCh38)
Location 17:50382936-50382958 17:50382987-50383009
Sequence CCATAGGAATCCAAACTCCAAGG CTCACTGCTGAGAGTCGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 172} {0: 2, 1: 1, 2: 0, 3: 4, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!