ID: 1148825773_1148825775

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1148825773 1148825775
Species Human (GRCh38) Human (GRCh38)
Location 17:50392818-50392840 17:50392852-50392874
Sequence CCAAAGTCTGCTGGCAGCTGCTG TACTCAGGTCTAGCTTCACCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 292} {0: 1, 1: 0, 2: 1, 3: 4, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!