ID: 1148826639_1148826647

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1148826639 1148826647
Species Human (GRCh38) Human (GRCh38)
Location 17:50398758-50398780 17:50398805-50398827
Sequence CCACTCCAAACCTCAGTTTACTC TTATCTCAGAGGGGCCGAGCAGG
Strand - +
Off-target summary {0: 2, 1: 8, 2: 115, 3: 676, 4: 2739} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!