ID: 1148826725_1148826730

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1148826725 1148826730
Species Human (GRCh38) Human (GRCh38)
Location 17:50399285-50399307 17:50399327-50399349
Sequence CCAGATCCAGAGGGGTGGAAGTC CAGCAAACAGCAGTAGTGGACGG
Strand - +
Off-target summary {0: 28, 1: 72, 2: 82, 3: 94, 4: 145} {0: 2, 1: 29, 2: 94, 3: 130, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!