ID: 1148826726_1148826730

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1148826726 1148826730
Species Human (GRCh38) Human (GRCh38)
Location 17:50399291-50399313 17:50399327-50399349
Sequence CCAGAGGGGTGGAAGTCAGCAGC CAGCAAACAGCAGTAGTGGACGG
Strand - +
Off-target summary No data {0: 2, 1: 29, 2: 94, 3: 130, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!