ID: 1148830816_1148830825

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1148830816 1148830825
Species Human (GRCh38) Human (GRCh38)
Location 17:50429886-50429908 17:50429908-50429930
Sequence CCTTCCCCCTATCTATGTGCCTC CCTTCCCCAAAGAAGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 354} {0: 1, 1: 0, 2: 2, 3: 23, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!