ID: 1148835918_1148835931

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1148835918 1148835931
Species Human (GRCh38) Human (GRCh38)
Location 17:50465717-50465739 17:50465761-50465783
Sequence CCCGGAGCTGGCAGGTACACTTC AGGGTCTCCAGGCTGTCGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 140} {0: 1, 1: 0, 2: 2, 3: 4, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!