ID: 1148852375_1148852383

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1148852375 1148852383
Species Human (GRCh38) Human (GRCh38)
Location 17:50561322-50561344 17:50561353-50561375
Sequence CCTCCCGGGGGCTCAGCTTGCGC CCACCAGATGTGCCCCCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 128} {0: 1, 1: 0, 2: 1, 3: 13, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!