ID: 1148854385_1148854393

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1148854385 1148854393
Species Human (GRCh38) Human (GRCh38)
Location 17:50570758-50570780 17:50570797-50570819
Sequence CCTTAATGCAAACCCTGAGGAAT ACAGAGAAGCTGAAGGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 151} {0: 1, 1: 0, 2: 6, 3: 53, 4: 694}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!