ID: 1148856587_1148856593

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1148856587 1148856593
Species Human (GRCh38) Human (GRCh38)
Location 17:50582313-50582335 17:50582350-50582372
Sequence CCGGCAGTGGTCCAGGCAGTTCA CCCTGGAAATGGAGAGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 154} {0: 1, 1: 0, 2: 2, 3: 48, 4: 521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!