ID: 1148857255_1148857270

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1148857255 1148857270
Species Human (GRCh38) Human (GRCh38)
Location 17:50585570-50585592 17:50585620-50585642
Sequence CCTTGGCACTGCCTCTGATTAGG CAGTGTGCCCAGTGGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 20, 4: 162} {0: 1, 1: 3, 2: 6, 3: 38, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!