ID: 1148868899_1148868904

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1148868899 1148868904
Species Human (GRCh38) Human (GRCh38)
Location 17:50643961-50643983 17:50643977-50643999
Sequence CCATCTCGCAGGTGGGCAGGGGC CAGGGGCACTGGAGGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 219} {0: 1, 1: 0, 2: 8, 3: 60, 4: 591}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!